public class AffyProbeReader extends BasicLineMapParser<CompositeSequence,Collection<Reporter>>
Expected format is tabbed, NOT FASTA. A one-line header starting with the word "Probe" is REQUIRED. In later versions of the format the second field of the file (column) is omitted.
For 3' arrays, here is an example:
1494_f_at 1 325 359 1118 TCCCCATGAGTTTGGCCCGCAGAGT AntisenseFor exon arrays, we create the equivalent files from the GFF files provided by Affymetrix. The files are created off-line using a PERL script.
COMMENT_MARK, logMIN_PARSED_LINES_FOR_UPDATE, PARSE_ALERT_TIME_FREQUENCY_MSPARSE_ALERT_FREQUENCY| Constructor and Description |
|---|
AffyProbeReader() |
| Modifier and Type | Method and Description |
|---|---|
boolean |
containsKey(CompositeSequence key) |
Collection<Reporter> |
get(CompositeSequence key) |
protected CompositeSequence |
getKey(Collection<Reporter> newItem) |
Collection<CompositeSequence> |
getKeySet() |
Collection<Collection<Reporter>> |
getResults() |
void |
parse(InputStream is)
Parse a
InputStream. |
Collection<Reporter> |
parseOneLine(String line)
Handle the parsing of a single line from the input.
|
protected void |
put(CompositeSequence key,
Collection<Reporter> value) |
void |
setSequenceField(int sequenceField)
Set the index (starting from zero) of the field where the sequence is found.
|
parse, parsepublic void setSequenceField(int sequenceField)
sequenceField - sequence fieldpublic boolean containsKey(CompositeSequence key)
containsKey in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>public Collection<Reporter> get(CompositeSequence key)
get in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>public Collection<CompositeSequence> getKeySet()
getKeySet in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>public Collection<Collection<Reporter>> getResults()
getResults in interface Parser<Collection<Reporter>>getResults in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>public void parse(InputStream is) throws IOException
ParserInputStream.parse in interface Parser<Collection<Reporter>>parse in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>is - input streamIOException - if there is a problem while manipulating the filepublic Collection<Reporter> parseOneLine(String line)
LineParserparseOneLine in interface LineParser<Collection<Reporter>>parseOneLine in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>line - line to parseprotected CompositeSequence getKey(Collection<Reporter> newItem)
getKey in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>protected void put(CompositeSequence key, Collection<Reporter> value)
put in class BasicLineMapParser<CompositeSequence,Collection<Reporter>>Copyright © 2005–2023 Pavlidis lab, Michael Smith Laboratories and Department of Psychiatry, University of British Columbia. All rights reserved.